sunnyluvrena sunnyluvrena
  • 12-12-2022
  • Biology
contestada

5'
GCCATATATATAATTGTGGCCATGGGGCAAGTCCCCAAGGCGACCCTATAGGGGGCG 3'
3' CGGTATATATATTAACACCGGTACCCCGTTCAGGGGTTCCGCTGGGATATCCCCCGC 5'


18. Explain the type of nucleic acid portrayed in the sequence of nitrogenous bases displayed
above?

Respuesta :

Otras preguntas

~ Solving Literal Equations ~ Solve for y 4x + 2y = 14
16.1 is what percent of 70
2.51 in expanded and word form
How many cataracts were there along the Nile river?
During a 3-hour storm, it snow 2.5 inches. Jacob said that it snowed an average of about 8 inches per hour. What is the error?
convert 1,000,000 to scientific notation
Five more than twice a number is 17.
A ton avis,pourquoi les jeunes souffrent-ils des troubles alimentaire   please give me your opinions in french I am actually struggling
which of these are a bronsted acid, a bronsted base or are both the bronsted acid and the bronsted base? PO4^3-          ClO2-NH4+HCO3-H2PO4-
You bike for 2 hours at a speed no faster than 17.6 mph. Write an inequality that represents the possible number of miles you bike.