Gir325
Gir325 Gir325
  • 10-05-2018
  • History
contestada

how has the 14th amendment affected us today?

Respuesta :

Аноним Аноним
  • 10-05-2018
The 14th Amendment to the US constitution ratified in 1868, granted citizenship to all person born or naturalized in the United States!
Hope this helps!
can I get a brainleist!
Have a great day!
Answer Link

Otras preguntas

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
Hi i need help with this question.
Simplify the expression. 14+(-4)-6/7j-3/7j+7
Does anyone know how to do algebric?
The unanimous opinion in Brown V Board of Education was written by Reverend Oliver Brown. • all nine Supreme Court justices. • Thurgood Marshall. O Earl Warren.
Please find what the rent per unit needs to be to have a Net Operating Income (NOI) of $100,000. Assumptions Please use the following assumptions below: Rent pe
please help me with this math geometry. thank you.​
. Which list shows the numbers in descending order? a -19/2, -3 1/4, -1.2, 38/6, 7 b 7, 38/6, -19/2, -3 1/4, -1.2 c -19/2, 7, 38/6, -3 1/4, -1.2 d 7, 38/6, -1.2
In a parallelogram, the sum of the measures of the angles is ______?
Need help with English work