whitneystanley whitneystanley

11-09-2014
Geography

contestada

I am a quadrangle
I have 2 pairs of parallel sides
all of my angles are right angles
I am not a square

Respuesta :

ErzaKirkland ErzaKirkland

11-09-2014

It's a rectangle. It has everything the question asks for, it's just longer than a square.

Answer Link

Otras preguntas

Which of the following equations correctly describes how to calculate net income? a. net income = (cost of goods sold) - (net sales) - (operating expenses) b. n

Is “Because we are ashamed” a phrase or a clause?

helppp please thank you so much

The graph below is an example of which type of function? On a coordinate plane, a function decreases, has a point of inflection, and then continues to decrease.

I need this nowww!!!!

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

A person invest 7900 in an account growing at a rate allowing the money to double every 8 years. How much money would be in the account after 5 years, to the ne

Team leadership the main focus for____ levels. _____ is the ability to work independently with minimum supervision.Blank 1A. ClericalB. AssistantC. ManagerialD.

) Which expressions show the total area of the tiny house in square feet? Choose ALL that apply. 36x + 24 24x + 36 2.(12 + 3) 12(2x + 3)

What are the positive and the negative effects of the New Deal of rossevelt?