elvisepresly elvisepresly

11-11-2019
Mathematics

contestada

How would you set up part C to get the answer(answer if you can 60points)

How would you set up part C to get the answeranswer if you can 60points class=

Respuesta :

Sting7356 Sting7356

11-11-2019

Answer:

Step-by-step explanation:27=3/2*10+12

27=30/2+12

27=15+12

27=27

Answer Link

Otras preguntas

Environmental factors can influence the way genes are ________________.

Use the poem "The Fox" to answer the following question: Stanzas 2 through 7 of the poem begin in the middle of a sentence. How does this structure relate to th

Though atomic physicists have made significant progress at understanding how God created the atom, a there is not yet a complete understanding of all atomic int

Please answer Read the poem. The Whippoorwill by Madison Julius Cawein I. Above lone woodland ways that led To dells the stealthy twilights tread The west wa

im doing social studies and i need help ;-;

6th grade math help me pleaseeee

Me Podrian Ayudar Con Refranes De la Región Centro Del Estado De Guerrero Porfaa

Mike says that the bakery uses more granola to make 30 batches of Raisin Nut energy bars than to make 15 batches of Honey Almond energy bars. Is Mike correct? U

What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT

there is a check and Balance among 3 organs of government.explain