sergio9000 sergio9000

12-10-2020
Biology

contestada

Translate the following DNA sequence:
ATGCCATGGCATTGA

Respuesta :

chefchinoba2020 chefchinoba2020

12-10-2020

The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Answer Link

Otras preguntas

What is the conflict in the westing game? For example, "man vs. man" "man vs. society"

The ______ cloud service model provides virtual environments online that can be tailored to the needs of developers

The spread of a fungus in a hardwood forest causes the ecosystem's carrying capacity for oak trees to decrease. Which two terms describe the fungus in this scen

ASAP!! What are the two main ways to study the organization of the body? levels of organization and body systems cells and tissues levels chemical and molecu

What's the difference between a brand-name and a generic product apex?

How many bowls can Samantha put exactly 4 strawberries into?

Which process plays an important role in the cycling of both carbon and nitrogen? (The answer is not respiration)

. Researchers have found that psychologically androgynous people are more well-adjusted than those with stereotypically masculine or feminine character traits.

Opportunity cost may be defined as?

Can someone help me with this question?