cris6015 cris6015

12-11-2020
Mathematics

contestada

Please click the picture and answer the questions

Please click the picture and answer the questions class=

Respuesta :

kelbobagginstx kelbobagginstx

12-11-2020

Answer:

#9 slope is -2, y int is 3

#10 slope is 3/4, y int is 0

Answer Link

Otras preguntas

Type your response in the box. Describe how resilient you are. What factors do you think account for your level of resilience? What areas could you change to in

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

In order for P. multocida to survive and carry out cellular functions (and cause infection), the energy contained in each molecule of glucose must be converted

Enter an expression equivalent to (3x2 + 2y2 – 3x) - (2x2 + y2 - 2x) using the fewest number of possible terms

What is the simplified form of square root of 45?

Select all that apply. Which words in the sentence below should be capitalized? the senator thanked me for my input, but said the democratic party did not agree

Why does Wang Jingwei believe that an effective constitutional government can be achieved only after a revolution?

solve x +6 ≤11 for x

I need help with this equation it's confusing

What is the value of y? A. 120° B. 66° C. Cannot be determined D. 60°