25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

What is 155% of 50? a. 83 b. 77.5 c. 72 d. 93

If you add 15 calls and multiple them by the total of 67 keeps and there is only one 1 Jeep subtract that by 56 and add 100 divide by 6 how many would it be

Where is windsor castle in relation to buckingham palace.

In the __________ process, the artist creates clean-cut lines on a plate of copper, zinc, or steel by forcing a sharp burin across the surface with the heel of

Which TWO factors explain the change shown in the table? SSUSH2B. *

Read the poem in spirit of war by Angela Morganin spirit of war in spirit of death in spirit of all man suffering something within me laughs and sings and I mus

A boat travels 300.4 kilometers in 11 hours (with a constant speed) how much time will it take traveling 240 kilometersPLS HELPPPPP

If you had to explain the most important aspects of your life to someone important to you in 10 sentences, what would you say?

Why do you think the ball game is so important to the maya

2b + y = 15 is this an expression?