charityshear8193 charityshear8193

10-03-2022
SAT

contestada

Which value of x makes the equation 0. 75(x + 20) = 2 + 0. 5(x - 2) true?

Respuesta :

abdullahfaraz3 abdullahfaraz3

10-03-2022

Answer:

-56

Explanation:

From the equation:

0.75(x + 20) = 2 + 0.5(x - 2)

Open brackets

0.75x + 15 = 2 + 0.5x - 1

Collect like terms

0.75x - 0.5x = 2 - 1 - 15

0.25x = - 14

Divide both sides by 0.25

x = -56

Answer Link

Otras preguntas

B.Use the words inside the box to complete the chart below

what’s the missing side length? Round to the nearest tenth

solve the equation below 4(ax + 3) -3ax = 25 + 3.

Each salad contains red beans, Lima beans, and black eyed beans. Use the information below to determine how many of each of the three types of beans are needed

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

What is the coordinate of the midpoint of (2, 1) and (18, 7)?

Use the remainder theorem and synthetic division to find f(k) for the given value of k.

The sum of David’s weight and Mike’s weight is 180 pounds. If you subtract David’s weight from Mike’s weight, you get half of Mike’s weight. How much does Mike

were the Stonewall Riots an effective way to cause change? Why or why not?

if you subtract 12 from my number and multiply the difference by -6 the result is -90 what is my number