reena3552735 reena3552735
  • 11-12-2017
  • Social Studies
contestada

how does wind cause change in natural and human made structures

Respuesta :

andriansp andriansp
  • 28-12-2017
When air moves it picks up tiny bits of loose materials and moves the to other places. Soil carried by wind it scrapes rocks and eventually destroy its composition and this process is known as erosion.
Given enough time, this process will destroy both natural and human made structures no matter how strong and solitd they were.
Answer Link

Otras preguntas

In general, how is a simple linear regression model used to predict the response variable using the predictor variable?
j oivn this zo o m m e etin g for f un​
Kaci bought a birthday cake, like the one shown below, for her mother. If a = 5 inches, b = 5 inches, c = 9 inches, and d = 2 inches, what is the volume of the
Use the situation to answer the questions. Latisha has a new job that pays her weekly. She has arranged for the same amount from each paycheck to be deposited i
Solve the following inequality and plot the answer on the number line shown below. ​
Si 9 es igual a 40 Cuánto vale 13?
Which of the following functions represent the graph g(x) above?
seven increased by a factor of a number
What mass of oxygen is produced when 1.840 mol of H202 decomposes?
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated